View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_low_25 (Length: 452)
Name: NF1056_low_25
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 75 - 356
Target Start/End: Original strand, 6237306 - 6237587
Alignment:
| Q |
75 |
cgtgcatatctatacataattttttagagtttcacaatcatcctcgtcaatgatcatccaaattccttctagattaattattttgttgaatttgcaagcc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6237306 |
cgtgcatatctatacataattttttagagtttcacaatcatcctcgtcaatgatcatccaaattccttctagattaattattttgttgaatttgcaagcc |
6237405 |
T |
|
| Q |
175 |
cttctagattctaacctcacattgtcattgtcaaaataataatctcaacttgtctccacaaaataataatccataatttctatgtttgttaattagcagc |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6237406 |
cttctagattctaacctcacattgtcattgtcaaaataataatctcaacttgtctccacaaaataataatccataatttctatatttgttaattagcagc |
6237505 |
T |
|
| Q |
275 |
tctaaattgactaaatttaaagtaatatgtaaatgagacaaatttgctttgaaagcaatatagtgatgactgatacctacct |
356 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6237506 |
tctaaattgactaaaattaaagtaatatgtaaatgagacaaatttgctttgaaagcaatatagtgatgactgatacctacct |
6237587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University