View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_low_31 (Length: 439)
Name: NF1056_low_31
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_low_31 |
 |  |
|
| [»] scaffold1163 (1 HSPs) |
 |  |  |
|
| [»] scaffold0043 (6 HSPs) |
 |  |  |
|
| [»] scaffold1805 (2 HSPs) |
 |  |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0066 (1 HSPs) |
 |  |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0062 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 6e-84; HSPs: 26)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 118 - 367
Target Start/End: Original strand, 26631471 - 26631710
Alignment:
| Q |
118 |
aagagaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttaggaaggaacctcacaaaaataca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
26631471 |
aagagaagctgaacttgcgaggaatttcgcaacag--aaggctttgcaaatttaaaatcatcctttcctacattttaggagggagcctcacaa------- |
26631561 |
T |
 |
| Q |
218 |
aaaataggatagggtgtgattagtgtttttgttaatgtcgtcttgtttatgtatgcttagtactgcactcttttttccttcacctggttttatcccattg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
26631562 |
-aaataggatagggtgtgattagtgtttttgttaatgtcgttttgtttatgtaagcttagtactgcgctcttttttccttcatctggttttatcccattg |
26631660 |
T |
 |
| Q |
318 |
gattttacgggtaaggtttttaatgaggcagatctatcacattgttattc |
367 |
Q |
| |
|
| |||||| |||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
26631661 |
ggttttacaagtaaggtttttaatgatgcagatgtatcacattgttattc |
26631710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 236 - 372
Target Start/End: Original strand, 27350999 - 27351135
Alignment:
| Q |
236 |
attagtgtttttgttaatgtcgtcttgtttatgtatgcttagtactgcactcttttttccttcacctggttttatcccattggattttacgggtaaggtt |
335 |
Q |
| |
|
|||| ||||||| |||||| ||| || ||| |||| || |||| ||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
27350999 |
attattgtttttcttaatgccgtgttttttttgtacgcctagtgctgcactcttttttccttcacctggttttatcccattgggttttacaggtaaggtt |
27351098 |
T |
 |
| Q |
336 |
tttaatgaggcagatctatcacattgttattcccttg |
372 |
Q |
| |
|
||||||||||||| | ||||||| ||||||||||||| |
|
|
| T |
27351099 |
tttaatgaggcagttgtatcacactgttattcccttg |
27351135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 121 - 392
Target Start/End: Original strand, 28085788 - 28086053
Alignment:
| Q |
121 |
agaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttaggaaggaacctcacaaaaatacaaaa |
220 |
Q |
| |
|
||||||||||| || || ||| || ||||||| | |||||||||||||||||||| |||||||||||||||||||||| ||| ||| |||||| |
|
|
| T |
28085788 |
agaagctgaacgtgtgatgaagttggcaacag--aaggctttgtaaatttaaaatcttcctttcctacattttaggaagaaac-------aaacacaaaa |
28085878 |
T |
 |
| Q |
221 |
ataggatagggtgt---gattagtgtttttgttaatgtcgtcttgtttatgtatgcttagtactgcactcttttttccttcacctggttttatcccattg |
317 |
Q |
| |
|
|||| |||| | ||||| ||||||||||||||| ||||||||||||||||||| |||| |||||||| ||||||||| ||||||||| || |
|
|
| T |
28085879 |
ttaggctaggtcatcatgattatcgtttttgttaatgtcactttgtttatgtatgcttagtgctgcgctctttttcccttcacctagttttatcctttta |
28085978 |
T |
 |
| Q |
318 |
gattttacgggtaaggtttttaatgaggcagatctatcacattgttattcccttgagtattgattggactagtcc |
392 |
Q |
| |
|
| |||||| |||||||||||||||||||||| | |||| ||||||||||| ||| |||||||| || ||||||| |
|
|
| T |
28085979 |
ggttttacaggtaaggtttttaatgaggcagttgtatcctattgttattccgttgtgtattgataggcctagtcc |
28086053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 79; E-Value: 9e-37
Query Start/End: Original strand, 242 - 392
Target Start/End: Complemental strand, 19482215 - 19482065
Alignment:
| Q |
242 |
gtttttgttaatgtcgtcttgtttatgtatgcttagtactgcactcttttttccttcacctggttttatcccattggattttacgggtaaggtttttaat |
341 |
Q |
| |
|
|||||||||||| || | |||||| |||||| ||| || |||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||| |
|
|
| T |
19482215 |
gtttttgttaatctcattttgtttctgtatgtttactattgcactcttttttccttcacctggttttatcccattgggttttacaggcaaggtttttaat |
19482116 |
T |
 |
| Q |
342 |
gaggcagatctatcacattgttattcccttgagtattgattggactagtcc |
392 |
Q |
| |
|
||||||| | | ||||| ||||||||||| ||||||||||| ||||||| |
|
|
| T |
19482115 |
gaggcagttgtccgacattattattcccttgtgtattgattggcctagtcc |
19482065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 118 - 381
Target Start/End: Complemental strand, 27387901 - 27387644
Alignment:
| Q |
118 |
aagagaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttaggaaggaacctcacaaaaataca |
217 |
Q |
| |
|
|||||||||||||| ||| |||||||| ||||||| | |||||| |||||||| || || |||||||||| ||||||||||||| |||| || |
|
|
| T |
27387901 |
aagagaagctgaacgtgctaggaatttggcaacag--aaggcttttctaatttaaagtcttcatttcctacatattaggaaggaaccccacatgaa---- |
27387808 |
T |
 |
| Q |
218 |
aaaataggatagggtgtgattagtgtttttgttaatgtcgtcttgtttatgtatgc--ttagtactgcactcttttttccttcacctggttttatcccat |
315 |
Q |
| |
|
|||||| |||||| ||||| || |||||||||||| | ||||||||||||| |||||| ||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
27387807 |
--aataggttagggtacgattatggtgtttgttaatgtcattttgtttatgtatgtgtttagtaatgcgctcttttttccttcatctggttttatcccat |
27387710 |
T |
 |
| Q |
316 |
tggattttacgggtaaggtttttaatgaggcagatctatcacattgttattcccttgagtattgat |
381 |
Q |
| |
|
||| |||||| ||||||||||||||||||||| | ||| ||| | ||||||||||| | |||||| |
|
|
| T |
27387709 |
tgggttttacaggtaaggtttttaatgaggcaactgtattacaatattattcccttgtgcattgat |
27387644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 267 - 372
Target Start/End: Original strand, 27381058 - 27381162
Alignment:
| Q |
267 |
tgtatgcttagtactgcactcttttttccttcacctggttttatcccattggattttacgggtaaggtttttaatgaggcagatctatcacattgttatt |
366 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| | ||| ||| ||||||| |
|
|
| T |
27381058 |
tgtacgcttagtgctgcactcttttttccttcacctggttttatcccattgggttttac-agtaaggtttttaatgaggcagttgtatgacactgttatt |
27381156 |
T |
 |
| Q |
367 |
cccttg |
372 |
Q |
| |
|
|||||| |
|
|
| T |
27381157 |
cccttg |
27381162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 118 - 385
Target Start/End: Original strand, 19478173 - 19478448
Alignment:
| Q |
118 |
aagagaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttaggaaggaacctcacaaaa----- |
212 |
Q |
| |
|
|||||||||||||| |||||||||| | ||||||| | ||||||| | |||| || || || |||||||||||||||||||||||| | | | |
|
|
| T |
19478173 |
aagagaagctgaacgtgcgaggaatctggcaacag--aaggctttgcagatttgaagtcttcatttcctacattttaggaaggaaccagatatatgcccc |
19478270 |
T |
 |
| Q |
213 |
-atacaaaaataggatagggtgt---gattagtgtttttgttaatgtcgtcttgtttatgtatgcttagtactgcactctttt--ttccttcacctggtt |
306 |
Q |
| |
|
| |||||||||| |||| ||| ||||| |||||||||||||| | |||||| |||||||||||| |||| || |||| ||||||||||||||| |
|
|
| T |
19478271 |
cacacaaaaatagactaggttgtcttgattatcgtttttgttaatgtatt-ttgtttctgtatgcttagtgctgcgcttttttttttccttcacctggtt |
19478369 |
T |
 |
| Q |
307 |
ttatcccattggattttacgggtaaggtttttaatgaggcagatctatcacattgttattcccttgagtattgattgga |
385 |
Q |
| |
|
|||||| ||||| |||||| ||||||||||||||||||||| | ||||||| |||| ||| |||| |||||||||||| |
|
|
| T |
19478370 |
ttatcctattgggttttacaggtaaggtttttaatgaggcaattgtatcacactgttgttcacttgggtattgattgga |
19478448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 244 - 366
Target Start/End: Original strand, 28006831 - 28006956
Alignment:
| Q |
244 |
ttttgttaatgtcgtcttgtttatg---tatgcttagtactgcactcttttttccttcacctggttttatcccattggattttacgggtaaggtttttaa |
340 |
Q |
| |
|
|||| |||||||||| |||||||| || ||||||| ||||||||||||||||||| ||||||||||||| | ||| ||||| |||||||||||||| |
|
|
| T |
28006831 |
tttttttaatgtcgttttgtttataacatacgcttagtgctgcactcttttttccttcccctggttttatcctactgggttttataggtaaggtttttaa |
28006930 |
T |
 |
| Q |
341 |
tgaggcagatctatcacattgttatt |
366 |
Q |
| |
|
|||||||| | |||| || ||||||| |
|
|
| T |
28006931 |
tgaggcagttgtatcccaatgttatt |
28006956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 280 - 347
Target Start/End: Complemental strand, 2978579 - 2978511
Alignment:
| Q |
280 |
ctgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||| | |||||||||||||| |||||| |
|
|
| T |
2978579 |
ctgcactcttttttccttcaccaaggttttatcccattgggttttcctggtaaggtttttaacgaggca |
2978511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 119 - 202
Target Start/End: Original strand, 26632306 - 26632387
Alignment:
| Q |
119 |
agagaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttaggaaggaa |
202 |
Q |
| |
|
||||||||||| | |||||||||||| |||| || | |||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26632306 |
agagaagctgagcgtgcgaggaatttggcaaaag--aaggctttacaaatttaaaatcatcatttcctacattttaggaaggaa |
26632387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 2168996 - 2168925
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
2168996 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
2168925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 3110853 - 3110782
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
3110853 |
ctgcactctttttcccttaaccatggttttatcccattgggtttttctggtaaggtttttaacgaggcagat |
3110782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 13990646 - 13990717
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
13990646 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
13990717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 23344190 - 23344261
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
23344190 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
23344261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 118 - 204
Target Start/End: Original strand, 27380762 - 27380846
Alignment:
| Q |
118 |
aagagaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttaggaaggaacc |
204 |
Q |
| |
|
|||||||||||||| || ||||||| | ||||||| | ||||||| ||||||||| || || |||||||||||||||||||||||| |
|
|
| T |
27380762 |
aagagaagctgaacgtgtgaggaatctggcaacag--aaggctttgcaaatttaaagtcttcatttcctacattttaggaaggaacc |
27380846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 281 - 350
Target Start/End: Complemental strand, 40800982 - 40800912
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
40800982 |
tgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
40800912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 327 - 383
Target Start/End: Original strand, 27981373 - 27981429
Alignment:
| Q |
327 |
ggtaaggtttttaatgaggcagatctatcacattgttattcccttgagtattgattg |
383 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||| ||||||||||||| |||||||||| |
|
|
| T |
27981373 |
ggtaaggtttttaatgaggcagttgtatgacactgttattcccttgtgtattgattg |
27981429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 9724969 - 9724898
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||| | |||| | |||||||||||||| ||||||||| |
|
|
| T |
9724969 |
ctgcactctttttcccttaaccatggttttatcccatttggttttcctggtaaggtttttaacgaggcagat |
9724898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 49487072 - 49487001
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
49487072 |
ctgcactctttttcccttaaccatggttttgtcccattgggttttcctggtaaggtttttaacgaggcagat |
49487001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 281 - 350
Target Start/End: Complemental strand, 13981000 - 13980930
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
13981000 |
tgcactctttttcccttaaccatggttttttcccattgggtttttctggtaaggtttttaacgaggcagat |
13980930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 346
Target Start/End: Original strand, 12990745 - 12990809
Alignment:
| Q |
283 |
cactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggc |
346 |
Q |
| |
|
||||||||||||||| | | ||||||||||||| | |||||| | |||||||||||||||||||| |
|
|
| T |
12990745 |
cactcttttttccttaagcatggttttatcccactagatttttctggtaaggtttttaatgaggc |
12990809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 21883235 - 21883306
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
21883235 |
ctgcactctttttcccttaaccatggttttgtcccattgggttttcttggtaaggtttttaacgaggcagat |
21883306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 281 - 350
Target Start/End: Complemental strand, 15752842 - 15752772
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||||| |||| | | ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
15752842 |
tgcactctttttcccttaatcatggttttgtcccattgggttttcctggtaaggtttttaacgaggcagat |
15752772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 281 - 346
Target Start/End: Original strand, 17032937 - 17033003
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggc |
346 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||| | |||| |||||||||||||| ||||| |
|
|
| T |
17032937 |
tgcactcttttttccttaaccatggttttatcccattaggttttcttggtaaggtttttaacgaggc |
17033003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 280 - 325
Target Start/End: Original strand, 21477323 - 21477369
Alignment:
| Q |
280 |
ctgcactcttttttccttcacct-ggttttatcccattggattttac |
325 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
21477323 |
ctgcactctttttcccttcacctaggttttatcccattgggttttac |
21477369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 281 - 356
Target Start/End: Original strand, 10937113 - 10937189
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagatctatca |
356 |
Q |
| |
|
||||||||| || |||||||| ||||||| ||||| ||| |||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
10937113 |
tgcactcttcttcccttcaccatggttttgtcccaatgggtttttatggtaaggtttttaatgagacagatatatca |
10937189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1163 (Bit Score: 100; Significance: 3e-49; HSPs: 1)
Name: scaffold1163
Description:
Target: scaffold1163; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 118 - 415
Target Start/End: Original strand, 1138 - 1426
Alignment:
| Q |
118 |
aagagaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttaggaaggaacctcacaaaaataca |
217 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||| | |||||| |||||||| || || |||||||||||||||||||||||| |||| | |
|
|
| T |
1138 |
aagagaagctgagcgtgcgaggaatttggcaacag--aaggcttttctaatttaaagtcttcgtttcctacattttaggaaggaaccccaca------cg |
1229 |
T |
 |
| Q |
218 |
aaaataggatagggtgtgattagtgtttttgttaatgtcgtcttgtttatgtatgcttagtactgcactcttttttccttcacctggttttatcccattg |
317 |
Q |
| |
|
|||||||| |||||| |||||| || ||||||||||| || ||||||||||||| |||||||||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
1230 |
aaaataggttagggtttgattatggtgtttgttaatgttgttttgtttatgtatgtttagtactgcgctcttttttccttcacctgcttttgtcccattg |
1329 |
T |
 |
| Q |
318 |
gattttacgggtaaggtttttaatgaggcagatctatcacattgttattcccttgagtattgattggactagtcctccaagttgtatattctttttat |
415 |
Q |
| |
|
| |||||| ||||||||||||||||||||| | ||| ||| | ||||||||||| | ||||||| ||||||| | |||||| || |||||||||| |
|
|
| T |
1330 |
ggttttacaggtaaggtttttaatgaggcaactgtattacaatattattcccttgtgaattgattttcctagtcc-caaagttgcatcttctttttat |
1426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 13)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 118 - 382
Target Start/End: Original strand, 22395734 - 22395990
Alignment:
| Q |
118 |
aagagaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttaggaaggaacctcacaaaaataca |
217 |
Q |
| |
|
|||||||||||||| |||||||||||| ||| ||| | |||||| |||||||| || || |||||||||||||||||||||| | |||| | |
|
|
| T |
22395734 |
aagagaagctgaacgtgcgaggaatttggcagcag--aaggcttttctaatttaaagtcttcgtttcctacattttaggaaggaagcacaca------cg |
22395825 |
T |
 |
| Q |
218 |
aaaataggatagggtgtgattagtgtttttgttaatgtcgtcttgtttatgtatgcttagtactgcactcttttttccttcacctggttttatcccattg |
317 |
Q |
| |
|
||||| || ||||||||||||| || |||| |||||| || ||||||||||||| |||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
22395826 |
aaaattggttagggtgtgattatggtgtttgctaatgttgttttgtttatgtatgtttagtactgcgctcttttttccttcacctggttttgtcccattg |
22395925 |
T |
 |
| Q |
318 |
gattttacgggtaaggtttttaatgaggcagatctatcacattgttattcccttgagtattgatt |
382 |
Q |
| |
|
| |||||| ||| ||||||||||||||| | | ||| ||| | ||||||||||| | ||||||| |
|
|
| T |
22395926 |
ggttttacaggttaggtttttaatgagggaactgtattacaatattattcccttgtgaattgatt |
22395990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 636096 - 636167
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
636096 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
636167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 22430162 - 22430233
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
22430162 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
22430233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 22435756 - 22435827
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
22435756 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
22435827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 283 - 350
Target Start/End: Original strand, 14898600 - 14898668
Alignment:
| Q |
283 |
cactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
14898600 |
cactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
14898668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 7910308 - 7910237
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||| ||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
7910308 |
ctgcactatttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
7910237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 19437884 - 19437813
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
19437884 |
ctgcactctttttgccttaaccatggttttgtcccattgggttttcctggtaaggtttttaacgaggcagat |
19437813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 281 - 351
Target Start/End: Original strand, 25231798 - 25231869
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagatc |
351 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||| | |||||| | ||||||||||||||||||| ||||| |
|
|
| T |
25231798 |
tgcactctttttcccttaaccatggttttatcccactagattttcctggtaaggtttttaatgaggaagatc |
25231869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 43776806 - 43776877
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | ||||| |||||||| ||||||||| |
|
|
| T |
43776806 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaagtttttaacgaggcagat |
43776877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 305 - 350
Target Start/End: Complemental strand, 7385174 - 7385129
Alignment:
| Q |
305 |
ttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
7385174 |
ttttatcccactggattttcctggtaaggtttttaatgaggcagat |
7385129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 290 - 350
Target Start/End: Complemental strand, 16443666 - 16443605
Alignment:
| Q |
290 |
ttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
16443666 |
ttttccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
16443605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 43287737 - 43287666
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| |||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
43287737 |
ctgcactctttttcccttaaccatggttttgtcccattgagttttcctggtaaggtttttaacgaggcagat |
43287666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 350
Target Start/End: Original strand, 11311886 - 11311933
Alignment:
| Q |
302 |
tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| ||| |||| | |||||||||||||||||||||||| |
|
|
| T |
11311886 |
tggttttatcccactgg-ttttcctggtaaggtttttaatgaggcagat |
11311933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 74; Significance: 9e-34; HSPs: 6)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 267 - 372
Target Start/End: Complemental strand, 50656 - 50551
Alignment:
| Q |
267 |
tgtatgcttagtactgcactcttttttccttcacctggttttatcccattggattttacgggtaaggtttttaatgaggcagatctatcacattgttatt |
366 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||| | ||||||| ||||||| |
|
|
| T |
50656 |
tgtacgcttagtgctgcactcttttttccttcacctggttttaacccattgggttttacaggtaaggtttttaatgaggcagttatatcacactgttatt |
50557 |
T |
 |
| Q |
367 |
cccttg |
372 |
Q |
| |
|
|||||| |
|
|
| T |
50556 |
cccttg |
50551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 280 - 412
Target Start/End: Original strand, 46253 - 46385
Alignment:
| Q |
280 |
ctgcactcttttttccttcacctggttttatcccattggattttacgggtaaggtttttaatgaggcagatctatcacattgttattcccttgagtattg |
379 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||| || |||||||||||||||||||||| | || ||||||||||||||||| ||||| |
|
|
| T |
46253 |
ctgcactcttttttcctttacctggttttatctcattggatttcacaggtaaggtttttaatgaggcagctgtacaacattgttattcccttgtatattg |
46352 |
T |
 |
| Q |
380 |
attggactagtcctccaagttgtatattctttt |
412 |
Q |
| |
|
| ||| |||||| ||| |||||| ||||||| |
|
|
| T |
46353 |
aatggcatagtcccccattttgtatcttctttt |
46385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 118 - 209
Target Start/End: Original strand, 29434 - 29523
Alignment:
| Q |
118 |
aagagaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttaggaaggaacctcaca |
209 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||| | |||||| |||||||| || || |||||||||||||||||||||||| |||| |
|
|
| T |
29434 |
aagaaaagctgaacttgcgaggaatttggcaacag--aaggcttttctaatttaaagtcttcgtttcctacattttaggaaggaaccccaca |
29523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 195
Target Start/End: Original strand, 31244 - 31316
Alignment:
| Q |
121 |
agaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttag |
195 |
Q |
| |
|
||||||||||| |||||||| ||| |||| || | ||||||| |||||||||||| || ||||||||||||||| |
|
|
| T |
31244 |
agaagctgaacgtgcgaggactttggcaaaag--aaggctttgcaaatttaaaatcttcgtttcctacattttag |
31316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 199
Target Start/End: Complemental strand, 50810 - 50734
Alignment:
| Q |
121 |
agaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttaggaag |
199 |
Q |
| |
|
||||||||||| | ||||||||| ||||||| | ||||||| ||||||||||| |||||||||||| ||||||||| |
|
|
| T |
50810 |
agaagctgaacgtatgaggaatttggcaacag--aaggctttgctaatttaaaatcttcctttcctacaatttaggaag |
50734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 121 - 196
Target Start/End: Original strand, 46103 - 46176
Alignment:
| Q |
121 |
agaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttagg |
196 |
Q |
| |
|
||||||||||| ||| |||| ||| |||| || | ||||||| |||||||||||| || |||||||||||||||| |
|
|
| T |
46103 |
agaagctgaacgtgcaaggactttggcaaaag--aaggctttgcaaatttaaaatcttcgtttcctacattttagg |
46176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1805 (Bit Score: 58; Significance: 3e-24; HSPs: 2)
Name: scaffold1805
Description:
Target: scaffold1805; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 274 - 392
Target Start/End: Original strand, 186 - 310
Alignment:
| Q |
274 |
ttagtactgcactcttttttccttcacctggttttatcccattggattttacgggtaaggtttttaatgaggcag------atctatcacattgttattc |
367 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || |||||| ||||||| |||||||||||||||||||||| | ||||||| | |||||| |
|
|
| T |
186 |
ttagtgctgcactcttttttccttcacctggtttcattccattgaattttacaggtaaggtttttaatgaggcagttgtacttgtatcacactattattc |
285 |
T |
 |
| Q |
368 |
ccttgagtattgattggactagtcc |
392 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
286 |
acttgggtattgattggactagtcc |
310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1805; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 118 - 204
Target Start/End: Original strand, 34 - 118
Alignment:
| Q |
118 |
aagagaagctgaacttgcgaggaatttcgcaacagctagggctttgtaaatttaaaatcatcctttcctacattttaggaaggaacc |
204 |
Q |
| |
|
|||||||||||||| || ||||||| | ||||||| | ||||||| ||||||||| || || | ||||||||||||||||| |||| |
|
|
| T |
34 |
aagagaagctgaacgtgtgaggaatctggcaacag--aaggctttgcaaatttaaagtcttcatatcctacattttaggaagaaacc |
118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 7e-16; HSPs: 10)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 19780360 - 19780289
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| |||||||||||||||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
19780360 |
ctgcactctttttcccttaaccatggttttatcccattggatttttctggtaaggtttttaacgaggcagat |
19780289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 281 - 347
Target Start/End: Complemental strand, 25365737 - 25365670
Alignment:
| Q |
281 |
tgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
25365737 |
tgcactcttttttccttcaccaaggttttatcccattgggttttcctggtaaggtttttaatgaggca |
25365670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 281 - 347
Target Start/End: Complemental strand, 25366010 - 25365943
Alignment:
| Q |
281 |
tgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
25366010 |
tgcactcttttttccttcaccaaggttttatcccattgggttttcctggtaaggtttttaatgaggca |
25365943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 28367326 - 28367255
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
28367326 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
28367255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 283 - 350
Target Start/End: Complemental strand, 30957939 - 30957871
Alignment:
| Q |
283 |
cactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
30957939 |
cactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
30957871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 16673320 - 16673391
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
16673320 |
ctgcactctttttcccttaaccatggttttgtcccattgggttttcctggtaaggtttttaacgaggcagat |
16673391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 17945562 - 17945633
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||| |||| | ||||||||||||| ||| ||||| |
|
|
| T |
17945562 |
ctgcactcttttttccttaaccgtggttttatcccattgggtttttcttgtaaggtttttaacgagacagat |
17945633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 18080299 - 18080228
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||| ||| |||| | ||||| |||||||||||||||||| |
|
|
| T |
18080299 |
ctgcactctttttcccttaaccatggttttatcccactgggttttcctggtaaagtttttaatgaggcagat |
18080228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 23053726 - 23053655
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
23053726 |
ctgcactctttttgccttaaccatggttttgtcccattgggttttcctggtaaggtttttaacgaggcagat |
23053655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 35264888 - 35264817
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
35264888 |
ctgcactctttttcccttaaccatggttttgtcccattgggttttcctggtaaggtttttaacgaggcagat |
35264817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 15)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 280 - 347
Target Start/End: Original strand, 29185340 - 29185408
Alignment:
| Q |
280 |
ctgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||| | |||||||||||||| |||||| |
|
|
| T |
29185340 |
ctgcactcttttttccttcaccaaggttttatcccattgggttttcctggtaaggtttttaacgaggca |
29185408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 16648237 - 16648308
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
16648237 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
16648308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 17622598 - 17622669
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
17622598 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
17622669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 25498869 - 25498940
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
25498869 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
25498940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 32148291 - 32148362
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
32148291 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
32148362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 42162600 - 42162529
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
42162600 |
ctgcactctttttcccttaaccatggttttatcccattgggtttttctggtaaggtttttaacgaggcagat |
42162529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 340641 - 340570
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
340641 |
ctgcactctttttcccttaaccatggttttgtcccattgggttttcctggtaaggtttttaacgaggcagat |
340570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 281 - 355
Target Start/End: Original strand, 20362471 - 20362546
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagatctatc |
355 |
Q |
| |
|
||||||||||||||| ||||| ||||||| |||| |||||||| | ||||||||||||||||| |||||| |||| |
|
|
| T |
20362471 |
tgcactcttttttccatcaccatggttttttccccatggatttttctggtaaggtttttaatgaagcagatatatc |
20362546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 558217 - 558156
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaa |
340 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| |
|
|
| T |
558217 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaa |
558156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 280 - 348
Target Start/End: Complemental strand, 25830731 - 25830662
Alignment:
| Q |
280 |
ctgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggcag |
348 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||| | |||||||||||| ||||||| |
|
|
| T |
25830731 |
ctgcactcttttttccttcaccaaggttttatcccattgggtttttctaataaggtttttaacgaggcag |
25830662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 301 - 350
Target Start/End: Original strand, 42208729 - 42208778
Alignment:
| Q |
301 |
ctggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
42208729 |
ctggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
42208778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 279 - 347
Target Start/End: Complemental strand, 32899035 - 32898967
Alignment:
| Q |
279 |
actgcactcttttttccttcacctggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
|||||||| || || ||||||| ||||||| ||||| |||||||| | ||||||||||||||| ||||| |
|
|
| T |
32899035 |
actgcacttttcttcccttcacatggttttgtcccaatggattttccaggtaaggtttttaataaggca |
32898967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 8247921 - 8247992
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| | | |||||||||||| ||||||||| |
|
|
| T |
8247921 |
ctgcactctttttcccttaaccatggttttgtcccattgggttttcctgataaggtttttaacgaggcagat |
8247992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 281 - 359
Target Start/End: Complemental strand, 26457191 - 26457113
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagatctatcacat |
359 |
Q |
| |
|
|||||||||||||| || ||| ||||||||||||||||| |||| | | ||||||||||| ||||||||| |||||||| |
|
|
| T |
26457191 |
tgcactcttttttcattaaccatggttttatcccattgggtttttctgaaaaggtttttaacgaggcagat-tatcacat |
26457113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 281 - 350
Target Start/End: Original strand, 20125082 - 20125152
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||| ||| |||| | | ||||||||||||| |||||||| |
|
|
| T |
20125082 |
tgcactctttttcccttaaccatggttttatcccactgggttttcctgataaggtttttaatcaggcagat |
20125152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 346016 - 345945
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
346016 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
345945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 17)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 6162063 - 6162134
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
6162063 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
6162134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 12746917 - 12746846
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||| ||| |||| | |||||||||||||||||||||||| |
|
|
| T |
12746917 |
ctgcactctttttcccttaaccatggttttatcccactgggtttttctggtaaggtttttaatgaggcagat |
12746846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 53981909 - 53981980
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
53981909 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
53981980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 281 - 350
Target Start/End: Complemental strand, 2924258 - 2924188
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||||||| ||| | ||||||||||| ||| |||| | |||||||||||||||||||||||| |
|
|
| T |
2924258 |
tgcactcttttttccttaaccatagttttatcccactgggttttcctggtaaggtttttaatgaggcagat |
2924188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 280 - 347
Target Start/End: Complemental strand, 911190 - 911122
Alignment:
| Q |
280 |
ctgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |||| | |||||||||||||| |||||| |
|
|
| T |
911190 |
ctgcactctttttcccttcaccaaggttttatcccattgggttttcctggtaaggtttttaacgaggca |
911122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 280 - 347
Target Start/End: Complemental strand, 12435690 - 12435622
Alignment:
| Q |
280 |
ctgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |||| | |||||||||||||| |||||| |
|
|
| T |
12435690 |
ctgcactctttttcccttcaccaaggttttatcccattgggttttcctggtaaggtttttaacgaggca |
12435622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 280 - 347
Target Start/End: Original strand, 29333455 - 29333523
Alignment:
| Q |
280 |
ctgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |||| | |||||||||||||| |||||| |
|
|
| T |
29333455 |
ctgcactctttttcccttcaccaaggttttatcccattgggttttcctggtaaggtttttaacgaggca |
29333523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 280 - 347
Target Start/End: Original strand, 42410922 - 42410990
Alignment:
| Q |
280 |
ctgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |||| | |||||||||||||| |||||| |
|
|
| T |
42410922 |
ctgcactctttttcccttcaccaaggttttatcccattgggttttcctggtaaggtttttaacgaggca |
42410990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 1874340 - 1874269
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
1874340 |
ctgcactctttttcccttaaccatggttttgtcccattgggttttcctggtaaggtttttaacgaggcagat |
1874269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 284 - 350
Target Start/End: Complemental strand, 20192933 - 20192866
Alignment:
| Q |
284 |
actcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
20192933 |
actctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
20192866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 281 - 347
Target Start/End: Original strand, 22748700 - 22748767
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||| ||| |||| | ||||||||||||||||||||| |
|
|
| T |
22748700 |
tgcactctttttcccttaaccatggttttatcccactgggttttcctggtaaggtttttaatgaggca |
22748767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 281 - 350
Target Start/End: Original strand, 23200338 - 23200408
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
23200338 |
tgcactctttttcccttaaccatggttttgtcccattgggttttcctggtaaggtttttaacgaggcagat |
23200408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 281 - 355
Target Start/End: Original strand, 6407756 - 6407832
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tgg-ttttatcccattggattttacgggtaaggtttttaatgaggcagatctatc |
355 |
Q |
| |
|
|||||||||||| |||||||| ||| |||| ||||| |||||||| | |||| ||||||||||||||||||| |||| |
|
|
| T |
6407756 |
tgcactctttttcccttcaccatggattttgtcccactggattttgctggtatggtttttaatgaggcagatatatc |
6407832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 12659534 - 12659463
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| || |||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
12659534 |
ctgcactctttttcccttaaccatgtttttgtcccattgggttttcctggtaaggtttttaacgaggcagat |
12659463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 13999810 - 13999881
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||| ||||||| ||| ||||| |
|
|
| T |
13999810 |
ctgcactctttttcccttaaccatggttttatcccattgggtttttctggtaagatttttaacgagacagat |
13999881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 16326062 - 16325991
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| | ||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
16326062 |
ctgcactctttttcccttaaccatggttttgttccattgggttttcctggtaaggtttttaacgaggcagat |
16325991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 280 - 347
Target Start/End: Complemental strand, 30674047 - 30673979
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
||||||||||||| |||| ||| || |||| ||||||||| |||| | |||||||||||||| |||||| |
|
|
| T |
30674047 |
ctgcactctttttcccttaaccatgtttttgtcccattgggttttcctggtaaggtttttaacgaggca |
30673979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 13)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 15716438 - 15716509
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
15716438 |
ctgcactctttttcccttaaccatggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
15716509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 281 - 347
Target Start/End: Original strand, 15552679 - 15552746
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||||||| |||||||| | ||||||||||||||| ||||| |
|
|
| T |
15552679 |
tgcactctttttcccttaaccatggttttatcccactggattttcctggtaaggtttttaatcaggca |
15552746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 31093295 - 31093224
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
31093295 |
ctgcactctttttcccttaaccatggttttgtcccattgggttttcctggtaaggtttttaacgaggcagat |
31093224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 37357077 - 37357006
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
37357077 |
ctgcactctttttcccttaaccatggttttgtcccattgggttttcctggtaaggtttttaacgaggcagat |
37357006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 40274779 - 40274708
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||| |||| | | |||||||||||| || |||||| |
|
|
| T |
40274779 |
ctgcactcttttttccttaaccatggttttatcccattgggttttcctgataaggtttttaacgaagcagat |
40274708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 281 - 350
Target Start/End: Original strand, 29547555 - 29547625
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| || |||| | | |||||||||||||||||||||| |
|
|
| T |
29547555 |
tgcactcttttttccttaaccatggttttatcccactgtgttttcctgataaggtttttaatgaggcagat |
29547625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 302 - 350
Target Start/End: Complemental strand, 27179292 - 27179244
Alignment:
| Q |
302 |
tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
27179292 |
tggttttatcccattgggttttcctggtaaggtttttaacgaggcagat |
27179244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 347
Target Start/End: Original strand, 38990915 - 38990983
Alignment:
| Q |
280 |
ctgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||||||||| |||| | |||||||||||||| |||||| |
|
|
| T |
38990915 |
ctgcgctctttttcccttcaccaaggttttatcccattgggttttcctggtaaggtttttaacgaggca |
38990983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 11659989 - 11660060
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| | | |||||||||||| ||||||||| |
|
|
| T |
11659989 |
ctgcactctttttcccttaaccatggttttgtcccattgggttttcctgataaggtttttaacgaggcagat |
11660060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 18535327 - 18535256
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| |||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
18535327 |
ctgcactctttttcccttaaccatggttttgtcccattgagttttcctggtaaggtttttaacgaggcagat |
18535256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 280 - 350
Target Start/End: Complemental strand, 33493281 - 33493211
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||||||||||||| ||| | |||||||||||||| ||||||||| |
|
|
| T |
33493281 |
ctgcactctttttcccttaaccatggttttatcccattgggtttc-ctggtaaggtttttaacgaggcagat |
33493211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 283 - 350
Target Start/End: Complemental strand, 145732 - 145664
Alignment:
| Q |
283 |
cactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||| |||| ||| ||||||||| ||| ||| |||| | | |||||||||||||||||||||| |
|
|
| T |
145732 |
cactctttttcccttaaccatggttttattccactgggttttcctgataaggtttttaatgaggcagat |
145664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 350
Target Start/End: Original strand, 17721554 - 17721602
Alignment:
| Q |
302 |
tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||||||| |||| | ||||| ||||||||||| |||||| |
|
|
| T |
17721554 |
tggttttatcccattggtttttcctggtaatgtttttaatgaagcagat |
17721602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.00000000001; HSPs: 9)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 280 - 347
Target Start/End: Original strand, 21247491 - 21247559
Alignment:
| Q |
280 |
ctgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |||| | |||||||||||||| |||||| |
|
|
| T |
21247491 |
ctgcactctttttcccttcaccaaggttttatcccattgggttttcctggtaaggtttttaacgaggca |
21247559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 280 - 347
Target Start/End: Complemental strand, 27679968 - 27679900
Alignment:
| Q |
280 |
ctgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |||| | |||||||||||||| |||||| |
|
|
| T |
27679968 |
ctgcactctttttcccttcaccaaggttttatcccattgggttttcctggtaaggtttttaacgaggca |
27679900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 281 - 350
Target Start/End: Complemental strand, 30714563 - 30714493
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
30714563 |
tgcactctttttcccttaaccatggttttgtcccattgggtttttctggtaaggtttttaacgaggcagat |
30714493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 281 - 350
Target Start/End: Complemental strand, 30722340 - 30722270
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
30722340 |
tgcactctttttcccttaaccatggttttgtcccattgggtttttctggtaaggtttttaacgaggcagat |
30722270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 280 - 347
Target Start/End: Original strand, 37209525 - 37209594
Alignment:
| Q |
280 |
ctgcactctttttt-ccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||| |||| | |||||||||||||| |||||| |
|
|
| T |
37209525 |
ctgcactctttttttccttcaccaaggttttatcccattgggtttttctggtaaggtttttaacgaggca |
37209594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 350
Target Start/End: Original strand, 10738785 - 10738852
Alignment:
| Q |
283 |
cactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| ||| |||| | |||||| ||||||||||||||||| |
|
|
| T |
10738785 |
cactcttttttccttaaccatggttttatcccactgg-ttttcccggtaagatttttaatgaggcagat |
10738852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 350
Target Start/End: Original strand, 23429349 - 23429417
Alignment:
| Q |
283 |
cactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||| |||| ||| ||| ||||||||| ||| |||| | |||||||||||||||||||||||| |
|
|
| T |
23429349 |
cactctttttcccttaaccatggatttatcccactgggttttcctggtaaggtttttaatgaggcagat |
23429417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 281 - 347
Target Start/End: Original strand, 8509597 - 8509664
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
|||| ||||||| |||| ||| |||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
8509597 |
tgcattctttttcccttaaccatggttttatcccattggattttcttggtaaggtttttaacgaggca |
8509664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 350
Target Start/End: Original strand, 41048696 - 41048744
Alignment:
| Q |
302 |
tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||||||| |||| | || |||||||||||| |||||||| |
|
|
| T |
41048696 |
tggttttatcccattgggttttcctggaaaggtttttaataaggcagat |
41048744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.00000000001; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 280 - 347
Target Start/End: Original strand, 23427297 - 23427365
Alignment:
| Q |
280 |
ctgcactcttttttccttcacct-ggttttatcccattggattttacgggtaaggtttttaatgaggca |
347 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||| |||| | |||||||||||||| |||||| |
|
|
| T |
23427297 |
ctgcactctttttcccttcaccaaggttttatcccattgggttttcctggtaaggtttttaacgaggca |
23427365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 283 - 350
Target Start/End: Original strand, 25397733 - 25397801
Alignment:
| Q |
283 |
cactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||| |||| ||| || |||||||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
25397733 |
cactctttttcccttaaccatgattttatcccactggattttcctggtaaggtttttaatgaggcagat |
25397801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 280 - 323
Target Start/End: Complemental strand, 19816912 - 19816868
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggatttt |
323 |
Q |
| |
|
||||||||||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
19816912 |
ctgcactctttttcccctcaccatggttttatcccattggatttt |
19816868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 280 - 348
Target Start/End: Complemental strand, 21847824 - 21847756
Alignment:
| Q |
280 |
ctgcactcttttttccttcacctggttttatcccattggattttacgggtaaggtttttaatgaggcag |
348 |
Q |
| |
|
|||||||||||||||||||| | |||||||| || | |||||| | |||||||||||||||||||| |
|
|
| T |
21847824 |
ctgcactcttttttccttcatcaagttttatctcaatagattttcttgttaaggtttttaatgaggcag |
21847756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 13837 - 13907
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| |||||||||||||||| ||||||||| |
|
|
| T |
13837 |
ctgcactcttttt-ccttaaccatggttttgtcccattgggttttccgggtaaggtttttaacgaggcagat |
13907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 350
Target Start/End: Original strand, 111686 - 111757
Alignment:
| Q |
280 |
ctgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||| | |||||||||||||| ||||||||| |
|
|
| T |
111686 |
ctgcactctttttcccttaaccatggttttgtcccattgggtttttctggtaaggtttttaacgaggcagat |
111757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 281 - 350
Target Start/End: Original strand, 11409 - 11479
Alignment:
| Q |
281 |
tgcactcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
|||||||||||| |||| | | ||||||||||||| ||| |||| | |||||||||||||||||||||||| |
|
|
| T |
11409 |
tgcactctttttcccttaaacatggttttatcccactgggtttttctggtaaggtttttaatgaggcagat |
11479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 340
Target Start/End: Complemental strand, 67741 - 67681
Alignment:
| Q |
280 |
ctgcactcttttttccttcacctggttttatcccattggattttacgggtaaggtttttaa |
340 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||| | |||||||||||| |
|
|
| T |
67741 |
ctgcactcttttttccttcaccaagttttatcctattggattttcttgttaaggtttttaa |
67681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 285 - 348
Target Start/End: Complemental strand, 159740 - 159676
Alignment:
| Q |
285 |
ctcttttttccttcacc-tggttttatcccattggattttacgggtaaggtttttaatgaggcag |
348 |
Q |
| |
|
||||||||||| ||||| |||||||||||| |||| |||| | |||||||||||||| ||||||| |
|
|
| T |
159740 |
ctcttttttccatcaccatggttttatccctttgggttttcctggtaaggtttttaacgaggcag |
159676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062 (Bit Score: 29; Significance: 0.0000006; HSPs: 2)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 350
Target Start/End: Original strand, 19691 - 19739
Alignment:
| Q |
302 |
tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||| | ||| |||| | |||||||||||||||||||||||| |
|
|
| T |
19691 |
tggttttatccaactgggtttttctggtaaggtttttaatgaggcagat |
19739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 302 - 350
Target Start/End: Original strand, 29859 - 29907
Alignment:
| Q |
302 |
tggttttatcccattggattttacgggtaaggtttttaatgaggcagat |
350 |
Q |
| |
|
||||||||||| | ||| |||| | |||||||||||||||||||||||| |
|
|
| T |
29859 |
tggttttatccgactgggtttttctggtaaggtttttaatgaggcagat |
29907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University