View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_low_33 (Length: 433)
Name: NF1056_low_33
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 97 - 405
Target Start/End: Complemental strand, 42275904 - 42275597
Alignment:
| Q |
97 |
tgtcgaataatattgtccaaattggcaaaggcaatagaaagcaagtacaataaagcgtgtggtccttgctttaagacaatagattgtcacagatcttctt |
196 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42275904 |
tgtccaataatattgtccaaattggcaaaggcaatagaaagcaagtacaataaagcgtgtggtccttgctttaagacaatagattgtcacagatcttctt |
42275805 |
T |
|
| Q |
197 |
caaacttcaaagccattggaacaacctgcacgtaatgtagtatcatattttgatgctttccatattctcttctcttcctaccgcaacttcatttaaagaa |
296 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42275804 |
caaacttcaaagccattgcaacaacctgcacgtaatgtagtatcatattttgatgctttccatattctcttctcttcctaccgcaactccatttaaagaa |
42275705 |
T |
|
| Q |
297 |
acctactcttagctcaaaaattgcaccaatttgtacaagtctaagccaaaacaacttgatggcaaaatgcacaaagtctctagttatgttcccaatcctc |
396 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42275704 |
acctactcttagctcaaaaattgcaccaa-ttgtacaagtctaagccaaaacaacttgatggcaaaatgcacaaagtctctagttatgttcccaatcctc |
42275606 |
T |
|
| Q |
397 |
ttgcaaact |
405 |
Q |
| |
|
||||||||| |
|
|
| T |
42275605 |
ttgcaaact |
42275597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University