View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_low_51 (Length: 349)
Name: NF1056_low_51
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 5 - 246
Target Start/End: Complemental strand, 39630311 - 39630069
Alignment:
| Q |
5 |
ataccatttccctc-taagccactgaaaccttgctccaagcgatatctatcctcgttgttcctcttctgaagaaaccttcttcattgtattagagattat |
103 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39630311 |
ataccatgtccctcctaagccactgaaaccttgctccaagcgatatctatcctcgttgttcctcttctgaagaaaccttcttcattgtattagagattat |
39630212 |
T |
|
| Q |
104 |
acgacctctaaaaatatttggtatgctctaggcttcatctcatttaaatttgtctcaaacccatacattgtcaattgttttaaatgctggctagcttctt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39630211 |
acgacctctaaaaatatttggtatgctctaggcttcatctcatttaaatttgtctcaaacccatacattgtcaattgttttaaatgctggctagcttctt |
39630112 |
T |
|
| Q |
204 |
cgagttccaacttctttgttgttggtgtttggtggtcttggag |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39630111 |
cgagttccaacttctttgttgttggtgtttggtggtcttggag |
39630069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University