View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1056_low_54 (Length: 338)

Name: NF1056_low_54
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1056_low_54
NF1056_low_54
[»] chr7 (1 HSPs)
chr7 (17-240)||(41564691-41564914)


Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 41564691 - 41564914
Alignment:
17 atgttggcgtgttggtgaagaaagaagatgtcgagagggctatagagaagttgatggatgacacgaattatgaaagtgaagagagaagaaaaagagctaa 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
41564691 atgttggcgtgttggtgaagaaagaagatgtcgagagggctatagagaagttgatgaatgacacgaattatgaaagtgaagagagaagaaaaagagctaa 41564790  T
117 ggagcttgcagagatggctaagaaaggtgtagaagaaggaggatcttctcacttcaatgtcacactattgattcaagatatccttcaacactcaacagag 216  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41564791 ggagcttgcagatatggctaagaaaggtgtagaagaaggaggatcttctcacttcaatgtcacactattgattcaagatatccttcaacactcaacagag 41564890  T
217 tagattgatgttgtttgcaacatt 240  Q
    ||||||||||||||||||||||||    
41564891 tagattgatgttgtttgcaacatt 41564914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University