View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_low_70 (Length: 286)
Name: NF1056_low_70
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_low_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 49 - 244
Target Start/End: Complemental strand, 546315 - 546120
Alignment:
| Q |
49 |
ctcctagagaatattctatgcagcagagataaatacccttgaggtgatcatgttttggtagatgcagtcctatggggaagnnnnnnnngggaaaaccatt |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
546315 |
ctcctagagaatattctatgcagcagagataaatacccttgaggtgatcatgttttggtagatgcagtcctatggggaagaaaaaaaagggaaaaccatt |
546216 |
T |
 |
| Q |
149 |
ctcaccaatataaaggagaattctggagtgtgttttgtgaggggagtatgctgagacattttatgtcaaaaggcacgagatatagtgattttgttg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
546215 |
ctcaccaatataaaggagaattctggagtgtgttttgtgaggggagtatgctgagacattttatgtcaaaaggcacgagatatagtgattgtgttg |
546120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University