View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_low_82 (Length: 265)
Name: NF1056_low_82
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_low_82 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 29 - 130
Target Start/End: Complemental strand, 38913273 - 38913172
Alignment:
| Q |
29 |
aatatgtatacttcgtaaataacttctaatttgaaacttttcttccggttaatccaaacataaaaatgggaaatgcacacgtacgcaacaacaatcttcc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38913273 |
aatatgtatacttcgtaaataacttctaatttgaaacttttcttccggttaatccaaacataaaaatgggaaatgcacacgtacgcaacaacaatcttcc |
38913174 |
T |
 |
| Q |
129 |
tt |
130 |
Q |
| |
|
|| |
|
|
| T |
38913173 |
tt |
38913172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 177 - 265
Target Start/End: Complemental strand, 38913126 - 38913038
Alignment:
| Q |
177 |
ctctttgatttgaagaatcatataaagtattgtgtgcgtgaagattcacctattttattttgacaattctaacaaaatgtaaataaatt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38913126 |
ctctttgatttgaagaatcatataaagtattgtgtgcatgaagattcacctattttattttgacaattctaacaaaatgtaaataaatt |
38913038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University