View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_low_84 (Length: 265)
Name: NF1056_low_84
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_low_84 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 109 - 243
Target Start/End: Original strand, 19276917 - 19277053
Alignment:
| Q |
109 |
cacagaatcaatcaaaagccaaatcacctcaacaaaaggttttgttaatttaatataaacaactactagtactattatttgtttgtcactgttgtttagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19276917 |
cacagaatcaatcaaaagccaaatcacctcaacaaaaggttttgttaatttaatgtaaacaactactagtactattatttgtttgtcactgttgtttagt |
19277016 |
T |
 |
| Q |
209 |
taa--tctctctctctttttgtctcctaaaccaagac |
243 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
19277017 |
taatctctctctctctttttgtctcctaaaccaagac |
19277053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University