View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_low_87 (Length: 256)
Name: NF1056_low_87
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_low_87 |
 | |
|
| [»] chr6 (3 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 30 - 256
Target Start/End: Complemental strand, 33641747 - 33641521
Alignment:
| Q |
30 |
ctaagtaagctaaatttttagagaagttgattaggcaacgtgaatctatcaattaaaaaaggcacatatcaatattatgaatgaacttaaaaaatgcata |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33641747 |
ctaagtaagctaaatttttagagaagttgattgggcaacgtgaatctatcaattaaaaaaggcacatatcaatattatgaatgaacttaaaaaatgcata |
33641648 |
T |
|
| Q |
130 |
tataaatattatgaacaagtttataagcgttgatttcgtggcaccttcttttcaataattattgattggtttataagtcaatcactatttgtaaacatga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33641647 |
tataaatattatgaacaagtttataagcgttgatttcgtggcaccttcttttcaataattattgattggtttataagtcaatcactatttgtaaacatga |
33641548 |
T |
|
| Q |
230 |
atgaagccgtatggttcttgctttcaa |
256 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
33641547 |
atgaagccgtatggttcttgctttcaa |
33641521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 84 - 189
Target Start/End: Original strand, 33307495 - 33307605
Alignment:
| Q |
84 |
aaaaaaggcacatatcaatattatgaatgaacttaaaaaatgcat-atataaatattatgaac----aagtttataagcgttgatttcgtggcaccttct |
178 |
Q |
| |
|
|||||| ||| |||||||| |||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33307495 |
aaaaaaagcatatatcaatgttataaatgaacttaaaaaatgcattatataaatattatgaacgaacaagtttataagcgttgatttcgtggcaccttct |
33307594 |
T |
|
| Q |
179 |
tttcaataatt |
189 |
Q |
| |
|
| |||||||| |
|
|
| T |
33307595 |
taccaataatt |
33307605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 193
Target Start/End: Original strand, 33288635 - 33288675
Alignment:
| Q |
153 |
taagcgttgatttcgtggcaccttcttttcaataattattg |
193 |
Q |
| |
|
||||||||| |||||||||||||||||||||| | |||||| |
|
|
| T |
33288635 |
taagcgttggtttcgtggcaccttcttttcaaaatttattg |
33288675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 153 - 203
Target Start/End: Complemental strand, 17437724 - 17437673
Alignment:
| Q |
153 |
taagcgttgatttcgtggcaccttcttttcaataatt-attgattggtttat |
203 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| ||||||| |||||| |
|
|
| T |
17437724 |
taagcgttgatttcgtggcactttctttacaataattgattgatttgtttat |
17437673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University