View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1056_low_90 (Length: 254)
Name: NF1056_low_90
Description: NF1056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1056_low_90 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 32 - 254
Target Start/End: Complemental strand, 33386152 - 33385929
Alignment:
| Q |
32 |
gacaatatcaagttatggagagaaaaatggttgtgcacagaacctcttatgcatgtcttccacatactttattctgttgctgccaataagcatgcttcag |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33386152 |
gacaatatcaagttatggagagaaaaatggttgtgcacagaacctcttatgcatgtcttccacatactttattctgttgctgccaataagcatgcttcag |
33386053 |
T |
|
| Q |
132 |
taattgaatgtggcagtggaaattggagtggcgcagacctctatttgtatgcgaggg-tttatttttgcatatctgcttaatctaattgcaggaatcgct |
230 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33386052 |
taactgaatgtggcagtggaaattggagtggcgcagacctctatttgtatgcgagggttttatttttgcatatctgcttaatctaattgcaggaatcgct |
33385953 |
T |
|
| Q |
231 |
cctccacaaggggaaagcgacatg |
254 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
33385952 |
cctccacaaggggaaagcaacatg |
33385929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University