View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10570_high_2 (Length: 250)
Name: NF10570_high_2
Description: NF10570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10570_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 8698051 - 8697812
Alignment:
| Q |
1 |
atctgagttgacttaccaaggcttttcaaatggttctggtaatggtttttatggctcttttgatggagttaacactatggaatcggatgattctaatcaa |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
8698051 |
atctgagttgatttaccaaggcttttcaaatggttctggtaatggtttttatggctcttttggtggagttaacactatggaatcagatgattctaatcaa |
8697952 |
T |
|
| Q |
101 |
tctaaaattggtgttaggaattgctccaatcttattaggcaaaagagttcacctgctgaatttttctctaatgaaaatggtatgaattttatcttatttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8697951 |
tctaaaattggtgttaggaattgctccaatcttattaggcaaaagagttcacctgctgaatttttctctaatgaaaatggtatgaattttatcttatttg |
8697852 |
T |
|
| Q |
201 |
caaactgttatagattttactatgtgctttttcccctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8697851 |
caaactgttatagattttactatgtgctttttcccctatg |
8697812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 9049938 - 9049699
Alignment:
| Q |
1 |
atctgagttgacttaccaaggcttttcaaatggttctggtaatggtttttatggctcttttgatggagttaacactatggaatcggatgattctaatcaa |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9049938 |
atctgagttgatttaccaaggcttttcaaatggttctggtaatggtttttatggctcttttggtggagttaacactatggaatcagatgattctaatcaa |
9049839 |
T |
|
| Q |
101 |
tctaaaattggtgttaggaattgctccaatcttattaggcaaaagagttcacctgctgaatttttctctaatgaaaatggtatgaattttatcttatttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9049838 |
tctaaaattggtgttaggaattgctccaatcttattaggcaaaagagttcacctgctgaatttttctctaatgaaaatggtatgaattttatcttatttg |
9049739 |
T |
|
| Q |
201 |
caaactgttatagattttactatgtgctttttcccctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9049738 |
caaactgttatagattttactatgtgctttttcccctatg |
9049699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 119 - 168
Target Start/End: Complemental strand, 13411388 - 13411339
Alignment:
| Q |
119 |
aattgctccaatcttattaggcaaaagagttcacctgctgaatttttctc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
13411388 |
aattgctccaatcttattaggcaaaagagttctcctgctgagtttttctc |
13411339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University