View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10570_low_6 (Length: 277)
Name: NF10570_low_6
Description: NF10570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10570_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 42636690 - 42636947
Alignment:
| Q |
1 |
ttttcagtaacagtcttgcgcgacatgatgcgtcttaagcagtgacgagacactttcaactcttcacaattgcgtgacacgtggattgtagcacgcatcg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
42636690 |
ttttcagtaacagtcttgcgcgatgtgatgcgtcttaagcagtgacgagacactttcaactcttcacaattgcatgacatgtggattgtagcacgcatcg |
42636789 |
T |
|
| Q |
101 |
tgcatgtactagtagtggatccttttgattttcttcattccttgtcatatttctcctcactgaaatatttgtagtgactatacatnnnnnnntcacctga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
42636790 |
tgcatgtactagtagtggatccttttgattttcttcattccttgtcatatttctcctcactgaaacatttgtagtgactatacatcaaaaaatcacctga |
42636889 |
T |
|
| Q |
201 |
tataccatctaagaaagtataacatgaccacaaaattgtctagttcaggtgatttagc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42636890 |
tataccatctaagaaagtataacatgaccacaaaattgtctagttcaggtgatttagc |
42636947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 86 - 146
Target Start/End: Complemental strand, 23072568 - 23072508
Alignment:
| Q |
86 |
ttgtagcacgcatcgtgcatgtactagtagtggatccttttgattttcttcattccttgtc |
146 |
Q |
| |
|
|||||||||||||| ||||||| |||||| ||||||| || ||||||||||| |||||| |
|
|
| T |
23072568 |
ttgtagcacgcatcaaacatgtaccagtagttgatccttatgcttttcttcattacttgtc |
23072508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 241
Target Start/End: Original strand, 33036922 - 33036970
Alignment:
| Q |
193 |
tcacctgatataccatctaagaaagtataacatgaccacaaaattgtct |
241 |
Q |
| |
|
|||| ||||||| | | ||||||||||||||||||||||||| |||||| |
|
|
| T |
33036922 |
tcacttgatatatcttgtaagaaagtataacatgaccacaaagttgtct |
33036970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University