View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10570_low_8 (Length: 242)

Name: NF10570_low_8
Description: NF10570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10570_low_8
NF10570_low_8
[»] chr1 (1 HSPs)
chr1 (139-223)||(38838020-38838104)


Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 139 - 223
Target Start/End: Complemental strand, 38838104 - 38838020
Alignment:
139 caggattaagtgcaagccactcggtgtcaaacccaataacctttgtcttatgattggaattacttgttgaaccaaaagaaaaaat 223  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38838104 caggattaggtgcaagccactcggtgtcaaacccaataacctttgtcttatgattggaattacttgttgaaccaaaagaaaaaat 38838020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University