View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10570_low_9 (Length: 240)
Name: NF10570_low_9
Description: NF10570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10570_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 8698102 - 8698274
Alignment:
| Q |
1 |
ttgtttcacaggtttcacatcaaactcttgcatattttcttcagaattgttccatccattgttggatgatatcaacttggataacatggtatccatttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8698102 |
ttgtttcacaggtttcacatcaaactcttgcaaattttcttcagaattgttccatccattgttggatgatatcaacttggataacatggtatccatttct |
8698201 |
T |
 |
| Q |
101 |
gaacttgtggatggaagataactctcatttgtaaaagattcttcattgttgatatagttttgagcgttgttgt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8698202 |
gaacttgtggatggaagataactctcatttgtaaacgattcttcattgttgataaagttttgagcgttgttgt |
8698274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 9049989 - 9050161
Alignment:
| Q |
1 |
ttgtttcacaggtttcacatcaaactcttgcatattttcttcagaattgttccatccattgttggatgatatcaacttggataacatggtatccatttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9049989 |
ttgtttcacaggtttcacatcaaactcttgcaaattttcttcagaattgttccatccattgttggatgatatcaacttggataacatggtatccatttct |
9050088 |
T |
 |
| Q |
101 |
gaacttgtggatggaagataactctcatttgtaaaagattcttcattgttgatatagttttgagcgttgttgt |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9050089 |
gaacttgtggatggaagataactctcatttgtaaacgattcttcattgttgataaagttttgagcgttgttgt |
9050161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University