View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10571_high_8 (Length: 215)
Name: NF10571_high_8
Description: NF10571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10571_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 29 - 181
Target Start/End: Complemental strand, 29161542 - 29161393
Alignment:
| Q |
29 |
atggtatccaaggcagtgacacgtgtgaggaaggtgagaagcaaacttcacacgaatcacaccatccttcctgactgagtagcccgcccacaacccagaa |
128 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29161542 |
atggtatcctaggcagtgacacgtgtgaggaaggtgagaggcaaacttcacacgaatcacaccatccttc----ctgagtagcccgcccacaacccagaa |
29161447 |
T |
 |
| Q |
129 |
aggtgcatgtcagcatttgggttagta-ttttgaactttcaaaatacaacccca |
181 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29161446 |
aggtgcatgtcagcatttgggttagtatttttgaactttcaaaatacaacccca |
29161393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University