View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10571_low_10 (Length: 229)
Name: NF10571_low_10
Description: NF10571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10571_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 15 - 213
Target Start/End: Complemental strand, 32031980 - 32031781
Alignment:
| Q |
15 |
agagaaggcaatatcatcgtgaatgtaagcaaaattattggaaggcattgaagctgagattagattactgcagtggatccaagaatagtaatactgnnnn |
114 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||| |||||||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32031980 |
agagaaggcaatatcttcgtgaatgtaagcagaatt---ggaaggcattgaagctgatattagattaccgcagtggatccaagaatagtaatactgtttt |
32031884 |
T |
|
| Q |
115 |
nnnagggttcgggt----gagagagataggggaatgattggttataatatagaagaaccgtctttttaagagatagtatccattgacttaagggttaagt |
210 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32031883 |
tttagggttccggtgagagagagagataggggaatgattgattataatatagaagaaccgtgtttttaagagatagtatccattgacttaagggttaagt |
32031784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University