View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10571_low_11 (Length: 216)
Name: NF10571_low_11
Description: NF10571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10571_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 9 - 203
Target Start/End: Complemental strand, 12544018 - 12543828
Alignment:
| Q |
9 |
agaagcaaaggagcacttattgatggagtgagaatccctttgtctagattgaacttatcctcttgatctataaaaatacgaaacatattattctttatcc |
108 |
Q |
| |
|
|||| |||| ||||||||||||| ||||||||||||||||||||| |||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12544018 |
agaaacaaacgagcacttattgacggagtgagaatccctttgtctggattaaacttatcctcttgttctataaaaatacgaaacatattattctttatcc |
12543919 |
T |
 |
| Q |
109 |
ttttaagtactgcacatcttnnnnnnnnnggcatcatatatacacacatttgcatgcatttttgaaatgtgttaatcaattcaaagtaaaatttg |
203 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||||||||| |||||| ||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
12543918 |
ttttaagtactgcacatcttaaaaataa--gtatc--atatacacacaattgcatacatttttgaaaggcgttaatcaattcaaagtaaaatttg |
12543828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University