View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10571_low_13 (Length: 214)
Name: NF10571_low_13
Description: NF10571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10571_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 14 - 198
Target Start/End: Complemental strand, 10797266 - 10797082
Alignment:
| Q |
14 |
aaagggacagaaatagagaagaggcaatgctggttttggctgaggttggaaggtcaatggagagttttccggcggatttggctgttgctgttaaggcagg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10797266 |
aaagggacagaaatagagaagaggcaatgctggttttagctgaggttggaaggtcaatggagagttttccggtggatttggctgttgctgttaaggcagg |
10797167 |
T |
|
| Q |
114 |
gagggtgccgggttcgatagtgaggaggttttttgagttggaggagtcagttgttttcagatggttgttaaaatttggagggttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10797166 |
gagggtgccgggttcgatagtgaggaggttttttgagttggaggagtcagttgttttccgatggttgttaaaatttggagggttt |
10797082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University