View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10571_low_14 (Length: 207)
Name: NF10571_low_14
Description: NF10571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10571_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 31188642 - 31188469
Alignment:
| Q |
1 |
ctttttgtgcttcatgtttctgtgttcctagtatcttttgctatgaatttgtttttagataggatggtttatgatggtttcttcttgctgcgttggcaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31188642 |
ctttttgtgcttcatgtttctgtgttcctagtatcttttgctatgaatttgattttagatag-atggtttatgatggtttcttcttgctgcgttggcaac |
31188544 |
T |
|
| Q |
101 |
tttgattgacgtagggaggatttttcttgtgggtaggtggatgtggaactttagtgtgggtgatgttagtctctg |
175 |
Q |
| |
|
|||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31188543 |
tttgatcgatgtagggaggttttttcttgtgggtaggtggatgtggaactttagtgtgggtgatgttagtctctg |
31188469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 34 - 175
Target Start/End: Complemental strand, 31200450 - 31200309
Alignment:
| Q |
34 |
tcttttgctatgaatttgtttttagataggatggtttatgatggtttcttcttgctgcgttggcaactttgattgacgtagggaggatttttcttgtggg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31200450 |
tcttttgctatgaatttgtttttagataggatggtttatgatggtttcttcttgctgcgttggcaactttgattgatgtagggaggttttttcttgtggg |
31200351 |
T |
|
| Q |
134 |
taggtggatgtggaactttagtgtgggtgatgttagtctctg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31200350 |
taggtggatgtggaactttagtgtgggtgatgttggtctctg |
31200309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University