View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10571_low_15 (Length: 206)
Name: NF10571_low_15
Description: NF10571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10571_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 18 - 94
Target Start/End: Complemental strand, 35787034 - 35786958
Alignment:
| Q |
18 |
ttttcaactgctgaagatgctgctaaagcttatgatcgtgctgctattattctctatggttctagggctcagcttaa |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787034 |
ttttcaactgctgaagatgctgctaaagcttatgatcgtgctgctattattctctatggttctagggctcagcttaa |
35786958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University