View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10571_low_4 (Length: 286)
Name: NF10571_low_4
Description: NF10571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10571_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 174
Target Start/End: Complemental strand, 35787112 - 35786958
Alignment:
| Q |
20 |
gtaagacaacgtagttggggtaaatgggttgctgaaattcgtgaaccacgtaaacgtactcgtaaatggcttggtactttttcaactgctgaagatgctg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787112 |
gtaagacaacgtagttggggtaaatgggttgctgaaattcgtgaaccacgtaaacgtactcgtaaatggcttggtactttttcaactgctgaagatgctg |
35787013 |
T |
|
| Q |
120 |
ctaaagcttatgatcgtgctgctattattctctatggttctagggctcagcttaa |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35787012 |
ctaaagcttatgatcgtgctgctattattctctatggttctagggctcagcttaa |
35786958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 34 - 67
Target Start/End: Complemental strand, 25896674 - 25896641
Alignment:
| Q |
34 |
ttggggtaaatgggttgctgaaattcgtgaacca |
67 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
25896674 |
ttggggtaaatgggttgctgagattcgtgaacca |
25896641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 34 - 66
Target Start/End: Original strand, 52690554 - 52690586
Alignment:
| Q |
34 |
ttggggtaaatgggttgctgaaattcgtgaacc |
66 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
52690554 |
ttggggtaaatgggttgctgaaatccgtgaacc |
52690586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University