View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10571_low_6 (Length: 266)
Name: NF10571_low_6
Description: NF10571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10571_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 32282242 - 32281987
Alignment:
| Q |
1 |
ctcatccgtgaccacctcctctctctcctcacaaactatccatcactcgaacctggaaccaacaccatgatttacaaaattagtcgccgcgccttcaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
32282242 |
ctcatccgtgaccacctcctctctctcctcacaaactatccaacactcaaacctggaaccaacaccatgatttacaaaattagtctcggcgccttcaaca |
32282143 |
T |
|
| Q |
101 |
tagtccaagccgacggcactattcccatgacctacaaagctgtaacttaccatactccaatagttatttctctactggaatcttaccctcgtcaccctcc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32282142 |
tagtccaagccgacagcactattcccatgacctacaaagctgtaacttaccatactccaatagttatttctctactggaatcttaccctcgtcaccctcc |
32282043 |
T |
|
| Q |
201 |
tctagtctatcttaaccctccaccatatttaaaaatcaaactccatcatccctatg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
32282042 |
tctagtctatcttaaccctccaccatatttgaaaatcaaactccatcatccttatg |
32281987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University