View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10573_high_5 (Length: 220)
Name: NF10573_high_5
Description: NF10573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10573_high_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 220
Target Start/End: Original strand, 52584647 - 52584850
Alignment:
| Q |
17 |
gtctgagagaaagtgattgaaaaaataaactagttctatacttgtattgtattgtgtcccttaagggaacaactcaattggaaaaatgaagcatgtgagt |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584647 |
gtctgagagaaagtgattgaataaataaactagttctatacttgtattgtattgtgtcccttaagggaacaactcaattggaaaaatgaagcatgtgagt |
52584746 |
T |
 |
| Q |
117 |
tttgtgatgtggatctctctagaacagtgaaagaagagagatttttatggaaaaagagaaaaggagtgaaagggggaatcgaatcgaatcgaatcaacac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584747 |
tttgtgatgtggatctctctagaacagtgaaagaagagagatttttatggaaaaggagaaaaggagtgaaagggggaatcgaatcgaatcgaatcaacac |
52584846 |
T |
 |
| Q |
217 |
tgtt |
220 |
Q |
| |
|
|||| |
|
|
| T |
52584847 |
tgtt |
52584850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University