View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10573_low_4 (Length: 241)
Name: NF10573_low_4
Description: NF10573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10573_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 12 - 158
Target Start/End: Complemental strand, 10771033 - 10770889
Alignment:
| Q |
12 |
catagggatcacaagttcgaatatagataaccacataaaatatcctatacaagaatttgacattttaagttgaactagaggttacatgctcatgtagcat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10771033 |
catagggatcacaagttcgaatatagataaccacataaaatatccta--caagaatttgacattttaagttgaactagatgttacatgctcatgtagcat |
10770936 |
T |
 |
| Q |
112 |
tgtaagttgagttaggcgtacaaactcaaatagcattataaaatata |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10770935 |
tgtaagttgagttaggcgtacaaactcaaatagcattgtaaaatata |
10770889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University