View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10573_low_6 (Length: 238)

Name: NF10573_low_6
Description: NF10573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10573_low_6
NF10573_low_6
[»] chr1 (1 HSPs)
chr1 (16-238)||(35046109-35046331)


Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 35046331 - 35046109
Alignment:
16 gttttatcaatgtgattgcgatagcattgctttgtaaaacacatttgtgtttaccatttgcggtttattttacagaatgacctgatccatgcatggggac 115  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
35046331 gttttatcaatgtgattgtgatagcattgctttgtaaaacacatttgtgtttaccacttgcggtttattttacagaatgacctgatccatgcatggggac 35046232  T
116 tagatatgcagcttggctactgctcccaggcaagttatgtatatcgatttcatcatttcacaaaattttgaactaatcacttgttctacgatatgctatt 215  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||    
35046231 tagatatgcagcttggctactgctctcaggcaagttatgtatatcgatttcattatttcacaaaattttgaactaatcacttgttctaccatatgctatt 35046132  T
216 tcaattttgtgaaacagaatttc 238  Q
    |||||||||||||||||||||||    
35046131 tcaattttgtgaaacagaatttc 35046109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University