View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10573_low_8 (Length: 231)
Name: NF10573_low_8
Description: NF10573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10573_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 66
Target Start/End: Original strand, 47322350 - 47322403
Alignment:
| Q |
13 |
cagagatagaagcagaagcagatggaagatcgttttcttcgtcatcgactaaaa |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47322350 |
cagagatagaagcagaagcagatggaagatcgttttcttcgtcatcgactaaaa |
47322403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 138 - 175
Target Start/End: Original strand, 47322475 - 47322512
Alignment:
| Q |
138 |
gggaaaacggtgtcgtgttgctgtgaagccatgggggg |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47322475 |
gggaaaacggtgtcgtgttgctgtgaagccatgggggg |
47322512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University