View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10573_low_9 (Length: 224)
Name: NF10573_low_9
Description: NF10573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10573_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 12 - 207
Target Start/End: Original strand, 33514334 - 33514529
Alignment:
| Q |
12 |
gagaagaaatataccaaacagagcttgtacaattattttcggaagaggatgaggtaagcttcataacttcttgtatttacatctttggacttacatcaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33514334 |
gagaagaaatataccaaacagagcttgtacaattattttcggaagaggatgaggtaggcttcataacttcttgtatttacatttttggacttacatcaat |
33514433 |
T |
 |
| Q |
112 |
atatatatgtgtgtgtgaaatatcctttttactattcacaggtacgtgtgttttttgcgatgcttgatgatgagctgaacaaagtgaaccaatttt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
33514434 |
atatatatgtgtgtgtgaaatatcctttttactattcacaggtacgtgtgttttttgcgatgcttgatgatgagctaaacaaggtgaaccaatttt |
33514529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 44064166 - 44064118
Alignment:
| Q |
31 |
agagcttgtacaattattttcggaagaggatgaggtaagcttcataact |
79 |
Q |
| |
|
||||||||| ||||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
44064166 |
agagcttgtgcaatttttttcggaggaggatgaggtaggcttcataact |
44064118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University