View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10574_low_4 (Length: 252)
Name: NF10574_low_4
Description: NF10574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10574_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 108 - 242
Target Start/End: Original strand, 30654536 - 30654670
Alignment:
| Q |
108 |
taaggacggcgaccatccttataccatatatactctgtcccattattataatattaataatgttatagtattattcactgtggggtttgcaactgccatt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30654536 |
taaggacggcgaccatccttataccatatatactctgtcccataattataatattaataatgttatagtattattcactgtggggtttgcaactgccatt |
30654635 |
T |
|
| Q |
208 |
tgttgtgctcgtcgttattgtttttgcgacctatg |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30654636 |
tgttgtgctcgtcgttattgtttttgcgacctatg |
30654670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 186 - 239
Target Start/End: Original strand, 38927753 - 38927806
Alignment:
| Q |
186 |
tgtggggtttgcaactgccatttgttgtgctcgtcgttattgtttttgcgacct |
239 |
Q |
| |
|
||||||||||||||| || ||| ||||||||||||||| ||||||| ||||||| |
|
|
| T |
38927753 |
tgtggggtttgcaaccgctattggttgtgctcgtcgttgttgttttggcgacct |
38927806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University