View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10576_high_3 (Length: 415)
Name: NF10576_high_3
Description: NF10576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10576_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 174 - 399
Target Start/End: Complemental strand, 46279336 - 46279111
Alignment:
| Q |
174 |
aatcatgaaattgtttgcagcatcaatttgaacaatttcaccaatccatggaaaaaccttgggaagcatacaacaaccgcatttaattaacatgctaccg |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279336 |
aatcatgaaattgtttgcagcatcaatttgaacaatttcaccaatccatggaaaaaccttgggaagcatacaacaaccgcatttaattaacatgctaccg |
46279237 |
T |
|
| Q |
274 |
tacttgcaccccttatcatcacctcctcctttttgtgtcagtcaggctcagaataaaatgcattatgcattgctgtgttatttctttgctttcctttttg |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279236 |
tacttgcaccccttatcatcacctcctcctttttgtgtcagtcaggctcagaataaaatgcattatgcattgctgtgttatttctttgctttcctttttg |
46279137 |
T |
|
| Q |
374 |
gaatgttatgtggtgaggtatcttca |
399 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
46279136 |
gaatgttatgtggtgaggtatcttca |
46279111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 46279509 - 46279392
Alignment:
| Q |
1 |
agcaaaggaacaacattcagatgaagataattctttgttcattatgagcaaatggagtccacctatgatgttcaattctctcaataaccttcaacaagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279509 |
agcaaaggaacaacattcagatgaagataattctttgttcattatgagcaaatggagtccacctatgatgttcaattctctcaataaccttcaacaagta |
46279410 |
T |
|
| Q |
101 |
agttcaaattagccatgc |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46279409 |
agttcaaattagccatgc |
46279392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University