View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10576_low_10 (Length: 241)
Name: NF10576_low_10
Description: NF10576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10576_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 38194855 - 38195079
Alignment:
| Q |
1 |
ccacatacaacactgatggaaaatctcattaccacatatcaggccaaacgtgttgaaagtacaccgaattaaaaccatcatgacccggacatctatctag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38194855 |
ccacatacaacactgatggaaaatctcattaccacatatcaggccaaacgtgttgaaagaacaccgaattaaaaccatcatgacccggacatctatctag |
38194954 |
T |
|
| Q |
101 |
tttcat-nnnnnnncatagcctctctaaattcatccaaagtgaaaggcgttgggagaatattatcatcctccatagttatggacggctcaatgatgttga |
199 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
38194955 |
tttcataaaaaaaacatagcctctctaaattcatccaaagtgaaaggcgttgggagaatatcatcatcctctatagttatggacggttcaatgatgttga |
38195054 |
T |
|
| Q |
200 |
agattggctcagtaatgctattctt |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
38195055 |
agattggctcagtaatgctattctt |
38195079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University