View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10576_low_13 (Length: 231)
Name: NF10576_low_13
Description: NF10576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10576_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 14 - 215
Target Start/End: Complemental strand, 26893493 - 26893292
Alignment:
| Q |
14 |
atgaaggattatattttcttagttaggtgctttaatttacaaacaagaatttgatgtgtgtttcaactctttttgaaggcactcgttgttttaaagaaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26893493 |
atgaaggattatattttcttagttaggtgctttaatttacaaacaagaatttgatgtgtgtttcaactctttttgaaggcactcgttgttttaaagaaag |
26893394 |
T |
 |
| Q |
114 |
gatctcagttaataaagtactgtcgaaaagccaagccaaaagttcgccctttcagactctccttggtaaggttttacttattatgagttatgaattgaat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26893393 |
gatctcagttaataaagtactgtcgaaaagccaagccaaaagttcgccctttcagactctccttggtaaggttttacttattatgagttatgaattgaat |
26893294 |
T |
 |
| Q |
214 |
tt |
215 |
Q |
| |
|
|| |
|
|
| T |
26893293 |
tt |
26893292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University