View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10576_low_6 (Length: 314)
Name: NF10576_low_6
Description: NF10576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10576_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 3 - 296
Target Start/End: Complemental strand, 25167695 - 25167402
Alignment:
| Q |
3 |
aggacctctaggaaagggaggtccttcagccgcgaagggatgtggggtggcctcatcgtaatcgtcatcctcatcagctagcgcatcagcctccacatgg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25167695 |
aggacctctaggaaagggaggtccttcagtcgcgaagggatgtggggtggcctcatcgtaatcgtcatcctcatcagccagcgcatcagcctccacatgg |
25167596 |
T |
 |
| Q |
103 |
ccaatgtcgtgaccctcaactgcttcctcatactgttgcgcgtcataaccacagttcgtgatatcgtgtagctgatcctaataattcaaatactaggtcg |
202 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
25167595 |
ccaatgttgtgaccctcaaccgcttcctcatactattgcgcgtcataaccacagttcgtgatatcatgtagctgatcctgataattcaaatactaggtcg |
25167496 |
T |
 |
| Q |
203 |
ggtcatccacctatgactttgtcggctcgaaacttccttcaccatcaatgggcctccgaccttttctcctcttaggcacatgaaggtttgccgc |
296 |
Q |
| |
|
|| ||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||| |||||||||| |||||||||||||||||||| |
|
|
| T |
25167495 |
ggccatccacctgtgactttgtcggctcggaacttccttcaccatcaatgggcctctaacctgttctcctctttggcacatgaaggtttgccgc |
25167402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University