View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10577_high_3 (Length: 254)
Name: NF10577_high_3
Description: NF10577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10577_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 239
Target Start/End: Original strand, 48755525 - 48755756
Alignment:
| Q |
8 |
atgtaataaccatatattttttccggttgtcaaacatggtatagagatgatcgtgcagtggaatcaagagataaaggtaggaaggtctgaatcttattta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
48755525 |
atgtaataaccatatattttttccggttgtcaaacatggtatagagatgatcgtgcagtggaatcaagagataaaggtaggaaggtctgaatcttatcta |
48755624 |
T |
 |
| Q |
108 |
tttgcaggtctgaaactatttacttgtttgataaaatacaaaagttaacgacctagaaggattcccttgtctcaccctatctgttatcgccattatgagc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
48755625 |
tttgcaggtctgaaactatttacttgtttgataaaatgcaaaagttaacgacctagaaggattcccttgtctccccctatctattatcgcctttatgagc |
48755724 |
T |
 |
| Q |
208 |
gattaagccttgaactgtatttgttgatgtcc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48755725 |
gattaagccttgaactgtatttgttgatgtcc |
48755756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 45 - 106
Target Start/End: Complemental strand, 11326842 - 11326781
Alignment:
| Q |
45 |
ggtatagagatgatcgtgcagtggaatcaagagataaaggtaggaaggtctgaatcttattt |
106 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
11326842 |
ggtatagatatgatcttgcagtggaatcaagagataaaggcaggaaggtcttaatcttattt |
11326781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 45 - 106
Target Start/End: Complemental strand, 11484863 - 11484802
Alignment:
| Q |
45 |
ggtatagagatgatcgtgcagtggaatcaagagataaaggtaggaaggtctgaatcttattt |
106 |
Q |
| |
|
|||||||| |||||| |||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
11484863 |
ggtatagatatgatcttgcagtggaatcaagagataaaggcaggaaggtcttaatcttattt |
11484802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 66 - 156
Target Start/End: Original strand, 47800250 - 47800340
Alignment:
| Q |
66 |
tggaatcaagagataaaggtaggaaggtctgaatcttatttatttgcaggtctgaaactatttacttgtttgataaaatacaaaagttaac |
156 |
Q |
| |
|
|||||||||||||||| | || ||| ||||||| |||| | |||||||||||||| |||||| || ||||||||||| |||| |||||| |
|
|
| T |
47800250 |
tggaatcaagagataacgatatgaatgtctgaaggttatctgtttgcaggtctgaatctatttgtttatttgataaaattcaaaggttaac |
47800340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University