View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10577_high_4 (Length: 252)
Name: NF10577_high_4
Description: NF10577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10577_high_4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 99 - 252
Target Start/End: Original strand, 48755238 - 48755389
Alignment:
| Q |
99 |
acaaaagtcttgcacatgaattatatcttgtcaaatgtgaatatgtgatacacnnnnnnnnaagtatattacatttgatataacttgttgcaattgtatt |
198 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48755238 |
acaaaagtcttgcaaatgaattatatcttgtcaaatgtgaatatgtgatacacttttttttaagtat--tacatttgatataacttgttgcaattgtatt |
48755335 |
T |
 |
| Q |
199 |
tcttgttagttttttagtgttccttggattccttttgtatttatgctacaatct |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48755336 |
tcttgttagttttttagtgttccttggattccttttgtatttatgttacaatct |
48755389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University