View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10578_low_22 (Length: 201)
Name: NF10578_low_22
Description: NF10578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10578_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 39135595 - 39135538
Alignment:
| Q |
121 |
gtggaggtttttaccaagtagttccatttgtgaaggttgaaatgaaagctttgtgtta |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39135595 |
gtggaggtttttaccaagtagttccatttgtgaaggttgaaatgaaagctttgtgtta |
39135538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 39135695 - 39135639
Alignment:
| Q |
16 |
tatacatatttaatagctctaacattacatgatattgatttactctacagatagcat |
72 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39135695 |
tatacacatttaatagctctaacattacatgatattgatttactctacagatagcat |
39135639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University