View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_high_12 (Length: 317)
Name: NF10579_high_12
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 41 - 299
Target Start/End: Original strand, 54076303 - 54076574
Alignment:
| Q |
41 |
actagatgagaatttattttatttgatt--gcttga---ttcttcttcttcttacatagatttttgattcggaggggacagattctcaacaaaagtaaac |
135 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54076303 |
actagatgagaatttattttatttgattccccttgattcttcttcttcttcttacatagatttttgattcggaggggacagattctcaacaaaagtaaac |
54076402 |
T |
 |
| Q |
136 |
----atggatggatcaatactatacatacacaggaacagttgaaaactattatagtgctctcttacattctgtttctctattccacnnnnnnnnaatgca |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
54076403 |
atggatggatggatcaatactatacatacacaggaacagttgaaaactattatagtgctctcttacattctgtttttctattccacttttttttaatgca |
54076502 |
T |
 |
| Q |
232 |
cggaatagaatttttgttgtcttcattgttccattttggacccctatag----ttgatactagtgtaggcag |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
54076503 |
aggaatagaatttttgttgtcttcattgttccattttggacccctatagttgattgatactagtgtaggcag |
54076574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 54076222 - 54076259
Alignment:
| Q |
1 |
gttagagatcaaaggttgaaattgttgacacgtgaatg |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54076222 |
gttagagatcaaaggttgaaattgttgacacgtgaatg |
54076259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University