View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_high_21 (Length: 256)
Name: NF10579_high_21
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 246
Target Start/End: Complemental strand, 56529771 - 56529544
Alignment:
| Q |
19 |
ccaccatccctgctgcgacggaatttgacgatactctaacaaaggatcagaaagctaagaagcttaaatctgtttatgagaaactctcttgcgaaggatt |
118 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56529771 |
ccaccatccctgctgcgacggagtttgacgatactctaacaaaggatcagaaagctaagaagcttaaatctgtttatgagaaactctcttgcgaaggatt |
56529672 |
T |
|
| Q |
119 |
cagtgatcatcaaattgagcttgctctttcggctctcaaggtatagtaatagtatcgtatgctttcaattgaaataattgattaatcgattctcttctct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56529671 |
cagtgatcatcaaattgagcttgctctttcggctctcaaggtatagtaatagtatagtatgctttcaattgaaataattgattaatcgattctcttctct |
56529572 |
T |
|
| Q |
219 |
ttctctttctaggaatgtgctacctttg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
56529571 |
ttctctttctaggaatgtgctacctttg |
56529544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University