View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_high_33 (Length: 237)
Name: NF10579_high_33
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_high_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 33599817 - 33599615
Alignment:
| Q |
16 |
agagatgtggtcattcaaatttaaataatcatagtcaattattttataaacagtaaacacgtcacgacctgtatcatgaagtcaatggggagggcctgtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33599817 |
agagatgtggtcattcaaatttaaataatcatagtcatttattttataaacagtaaacacgtcacgacctgtatcatgaagtcaatggggagggcctgtt |
33599718 |
T |
|
| Q |
116 |
tttgggggatggtttggacagcaggagcacttgttttaagtctctgttaggtgcnnnnnnnggctagtttttatgtctctattaggtgtgttttggcata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33599717 |
tttgggggatggtttggacagcaggagcacttgttttaagtctctgttaggtgctttttttggctagtttttatgtctctattaggtgtgttttggcata |
33599618 |
T |
|
| Q |
216 |
aca |
218 |
Q |
| |
|
||| |
|
|
| T |
33599617 |
aca |
33599615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University