View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_high_34 (Length: 234)
Name: NF10579_high_34
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_high_34 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 31 - 234
Target Start/End: Complemental strand, 41343283 - 41343075
Alignment:
| Q |
31 |
gatctaaaccgcagatttgagatcggacagttcatatttcaaacatatgatgtcacacaatctgagttaccaatttgatatcggacggacggcacaaatc |
130 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41343283 |
gatctcaactgcagatttgagatcggacagttcgtatttcaaacacatgatgtcacacaatctgagttaccaatttgatatcggacggacggcacaaatc |
41343184 |
T |
|
| Q |
131 |
aattacatagtcttcggaaaattcattccacgtttcttgtgaacagacaaacatgtacacaaga-----aaatgatttttatgttgaaattatacgtgta |
225 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41343183 |
aattacataatcttcagaaaattcattccacgtttcttgtgaacagacaaacatgtacacaagaaaattaaatgatttttatgttgaaattatacgtgta |
41343084 |
T |
|
| Q |
226 |
tatcgacat |
234 |
Q |
| |
|
||||||||| |
|
|
| T |
41343083 |
tatcgacat |
41343075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University