View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_high_9 (Length: 357)
Name: NF10579_high_9
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_high_9 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 177 - 357
Target Start/End: Complemental strand, 8460652 - 8460473
Alignment:
| Q |
177 |
atccaatcttcttttgatatgtcttctaccacttctgccattttttccaagtgaaagctactcccctagttggctgacgaagcaaatcatcattttctgt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8460652 |
atccaatcttcttttgatatgtcttctaccacttctgccattttt-ccaagtgaaagctactcccctagttggctgatgaagcaaatcatcattttctgt |
8460554 |
T |
 |
| Q |
277 |
ccaagattgaaagtccaccatagtaggtctagctggagtatgagaacaccaaggtgcatcattttgagactgcacattact |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8460553 |
ccaagattgaaagtccaccatagtaggtctagctggagtatgagaacaccaaggtgcatcattttgagactgcacattact |
8460473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 137 - 188
Target Start/End: Complemental strand, 8460728 - 8460677
Alignment:
| Q |
137 |
aagagcaacagtcaagccaattttgattgcacacaacacgatccaatcttct |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8460728 |
aagagcaacagtcaagccaattttgattgcacacaacacgatccaatcttct |
8460677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University