View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_101 (Length: 232)
Name: NF10579_low_101
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_101 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 216
Target Start/End: Complemental strand, 40839972 - 40839770
Alignment:
| Q |
14 |
caaaggcgatattgttttagagtgtggcttattaattcgatgtgcggatggagaatggcttagtggtttctacaaggatattggaagttgtagtgcgtat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839972 |
caaaggcgatattgttttagagtgtggcttattaattcgatgtgcggatggagaatggcttggtggtttctacaaggatattggaagttgtagtgcgtat |
40839873 |
T |
|
| Q |
114 |
atagccgaactgcagctggtgtgtattgattctgaatcggtcggtaagagtatttagcaaaatgggagtgtaacgtgttagtgctaatgggtggagatta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839872 |
atagccgaactgcagctggtgtgtattgattctgaatcggtcggtaagagtatttagcaaaatgggagtgtaacgtgttagtgctaatgggtggagatta |
40839773 |
T |
|
| Q |
214 |
gtg |
216 |
Q |
| |
|
||| |
|
|
| T |
40839772 |
gtg |
40839770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University