View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_103 (Length: 230)
Name: NF10579_low_103
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_103 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 15 - 214
Target Start/End: Complemental strand, 25680038 - 25679839
Alignment:
| Q |
15 |
ataggagaagtatatagatatatttaaggagacttgcnnnnnnnnttcaatctcaaactatttcatttcatcaattggtgctttgattccaccaataatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25680038 |
ataggagaagtatatagatatatttaaggagacttgcaaaaaaaactcaatctcaaactatttcatttcatcaattggtgctttgattccaccaataatt |
25679939 |
T |
|
| Q |
115 |
gccataaatagatcaaaggaaagtgtagaagcttgaaagttgtggaagctatagctagatgaatatgagggaggaagaagcatatggatcagaatgttcc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25679938 |
gccataaatagatcaaaggaaagtgtagaagtttgaaagttgtggaagctatagctagatgaatatgagggaggaagaagcatatggatcagaatgttcc |
25679839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University