View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_104 (Length: 230)
Name: NF10579_low_104
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_104 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 13 - 172
Target Start/End: Original strand, 2745611 - 2745770
Alignment:
| Q |
13 |
caaaggatgggaataggtctagtattagcaatcatagcaatggtttcagcaggattagtagagattttccggctaaagtatgcgataaaagaagnnnnnn |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2745611 |
caaaggatgggaataggtctagtattagcaatcatagcaatggtttcagcaggattagtagagattttccggctaaagtatgcgataaaagaagaaaaaa |
2745710 |
T |
|
| Q |
113 |
nttgtagcagttgcgaagggacgggttcgttgtcgatattttggcaagtgccgcaatatg |
172 |
Q |
| |
|
||||||| ||||||||||||| |||| || ||||||||||||||||| |||||||||| |
|
|
| T |
2745711 |
attgtagccattgcgaagggacgagttcattatcgatattttggcaagtaccgcaatatg |
2745770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University