View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_116 (Length: 203)
Name: NF10579_low_116
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_116 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 15 - 188
Target Start/End: Complemental strand, 31971443 - 31971266
Alignment:
| Q |
15 |
atgaagagttcataaaaagagcttacaatttccaggctcttcacagcaaccaaataaacctgttgtccattttccagttggtggaccattaatgtccgaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31971443 |
atgaagagttcataaaaagagcttacaatttccaggctcttcacagcaaccaaataaacctgttgtccattttccagttggtggaccattaatgtccgaa |
31971344 |
T |
|
| Q |
115 |
atttgtgcaccattatacatt----ttgaaccttagctagtgatcaaatggagatttaacaagtctatgtaactatgt |
188 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31971343 |
atttgtgcaccattatacattttgattgaaccttagctagtgatcaaatggagatttaacaagtctatgtaactatgt |
31971266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University