View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_117 (Length: 201)
Name: NF10579_low_117
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_117 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 18 - 182
Target Start/End: Original strand, 43322858 - 43323022
Alignment:
| Q |
18 |
agggttaatgatgatcagggttcaccaacgaccacaaattataactagctatatccaaaatcttaagacattgtgatttgtgaatatgtgtcacttctct |
117 |
Q |
| |
|
|||||||||||||||| ||| ||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43322858 |
agggttaatgatgatcggggctcaccaatgaccacaaattataattagatatatccaaaatcttaagacattgtgatttatgaatatgtgtcacttctct |
43322957 |
T |
|
| Q |
118 |
tataaagaactctctgattcgattcttcaataagatatggttttaactttatttttcttttgact |
182 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43322958 |
tataaagagctctctgattcgattcttcaataagatatggttttaactttctttttcttttgact |
43323022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University