View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_42 (Length: 305)
Name: NF10579_low_42
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 39676865 - 39677109
Alignment:
| Q |
1 |
tgtaagtagtatttattatccttaataataaaatgggcctaggattgcataatcttgtttggatcagtgtgcttcttccactgcatgttaaacgaagaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39676865 |
tgtaagtagtatttattatccttaataataaaatgggcctaggattgcataatcttgtttggatcagtgtacttcttccactgcatgttaaacgaagaac |
39676964 |
T |
|
| Q |
101 |
attctggaaacaacaggttttgtctttgcatcatcatcaaaatcccaaaacgaggtacaacgcagttttcttttgtctttgacaaggaatctagagtgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39676965 |
attctggaaacaacaggttttgtctttgcatcatcatcaaaatcccaaaacgaggtacaactcagttttcttttgtctttgacaaggaatctagagtgtt |
39677064 |
T |
|
| Q |
201 |
agaacttcttctctcaaaccaaaaatgaggtatatatgatttctg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39677065 |
agaacttcttctctcaaaccaaaaatgaggtatatatgatttctg |
39677109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University