View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_45 (Length: 301)
Name: NF10579_low_45
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_45 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 43 - 193
Target Start/End: Original strand, 49756124 - 49756274
Alignment:
| Q |
43 |
ccctcctgtgggctaacccctgggtcgcttgtgacnnnnnnnnngtcatgacaaactaaaatgatagggtcctaatactttgttaatattattatatctc |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
49756124 |
ccctcctgtgggctaacccctgggtcgcttgtgactttttttttgtcatgacaaactaaaatgatagggtcctaacactctgttaatattattatatctc |
49756223 |
T |
|
| Q |
143 |
actgtgtagaaacattggaacaaacaacactacataatatatcaactatta |
193 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
49756224 |
actgtgtagaaacattgaaacaaacaacactacataatatatcaattatta |
49756274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 189 - 254
Target Start/End: Original strand, 49757236 - 49757301
Alignment:
| Q |
189 |
tattaatctcaaaactcgtctagnnnnnnnttctcaaaattgacaaagcttatttcatataaacta |
254 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49757236 |
tattaatctcaaaactcgtctagaaaaaaaatctcaaaattgtcaaagcttatttcatataaacta |
49757301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 247 - 301
Target Start/End: Complemental strand, 22940731 - 22940677
Alignment:
| Q |
247 |
ataaactaggctaaagtgcactttnnnnnnnttaactttcaaaaacttgcaattt |
301 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22940731 |
ataaacttggctaaagtgcacttttccccccttaactttcaaaaacttgcaattt |
22940677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University