View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_50 (Length: 294)
Name: NF10579_low_50
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 9e-36; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 100 - 191
Target Start/End: Original strand, 18280220 - 18280312
Alignment:
| Q |
100 |
ttacaaagtgtgagtttcacatct-tcttcgacaaaatgtacttctcatttattttatgtaaaaaagtgaattatttttgcactctgatttca |
191 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18280220 |
ttacaaagtgtgagtttcacatctctcttcgacaaaatgtacttctcgtttattttttgtaaaaaagtgaattatttttgcactctgatttca |
18280312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 78
Target Start/End: Original strand, 18279772 - 18279840
Alignment:
| Q |
10 |
acatcaccaacaacttaaccgatcttgagcttggtgttcactgcaaagacaaaaatattgatattaagt |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18279772 |
acatcaccaacaacttaaccgatcttgagcttggtgttcactgcaaagacaaaaataatgatattaagt |
18279840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 246 - 282
Target Start/End: Original strand, 18280330 - 18280366
Alignment:
| Q |
246 |
ccttttcatctggcttcattttttctgttgtttgtga |
282 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18280330 |
ccttttcacctggcttcattttttctgttgtttgtga |
18280366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University