View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_66 (Length: 256)
Name: NF10579_low_66
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_66 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 18 - 243
Target Start/End: Original strand, 3111063 - 3111287
Alignment:
| Q |
18 |
atactttggtttttgatcacttaaaaggaagagaagttggtagttgttggaggtggagcagcaggggtgtatggagcaattcatgccaaaactattgcac |
117 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3111063 |
atactttggtttttgatcacttaaa-ggaagagaagttggtagttgttggaggtggagcagcaggggtgtatggagcaattcatgccaaaactattgcac |
3111161 |
T |
 |
| Q |
118 |
ctcacctaaatgtggtcattattgagaaggggaagcctctttccaaggtctgtgattgcatgtggatattactattggattgtattccatgtttctgttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3111162 |
ctcacctaaatgtggtcattattgagaaggggaagcctctttccaaggtctgcgattgcatgtggatattactattgggttgtattccatgtttctgttt |
3111261 |
T |
 |
| Q |
218 |
cattgttctcttttgttttgttcttc |
243 |
Q |
| |
|
| |||||||||||||||||||||||| |
|
|
| T |
3111262 |
cgttgttctcttttgttttgttcttc |
3111287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University