View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_75 (Length: 248)
Name: NF10579_low_75
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_75 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 20 - 177
Target Start/End: Complemental strand, 50537564 - 50537414
Alignment:
| Q |
20 |
cttcaacttcctcgtcttcatttggaactgctgtttcttttttctctttttagtcaattacaatttttaattaatnnnnnnnnnnnnnnnnntgatattt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
50537564 |
cttcaacttcctcgtcttcatttggaactgctgtttcttttttctctttttagtcaattacaatttttaattaat-------aaaataaaaatgatattt |
50537472 |
T |
|
| Q |
120 |
taatcaactcactgtttcttcatctgatcttgatcattttgattctctacaagtctga |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50537471 |
taatcaactcactgtttcttcatctgatcttgatcattttgattctctacaagtctga |
50537414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University